Sometimes it really sucks when you do something that, really, you should know better than to do.
Just in case anyone ever wants to know: don't walk into a room where they're running NMR without first removing your debit card from your person. It becomes somewhat embarrassing to attempt to use your card later on in the day.
I gotta hand it to Google Ads: they are great for unintentionally injecting humor into my days from time to time.
Case in point: I was recently reading a news story about some unbelievably violent and scary drug gangs in Mexico, and what was the first ad on the list?
Yup: "Would you like to live in Mexico?"
Tempting... but no.
Chimp might back me up here...
Dear client,
I understand as your photographer that you think your kids are, without a doubt, the cutest kids in the world. While I would probably disagree, the cuteness of your spawn is irrelevant. However, there are a few kid-related items I'd like to make you aware of prior to such a time as you see fit to retain my services.
Ahem...
Numero Uno: if you have kids that like to run around and you fail to properly leash them at a wedding, it's not my problem. If the happy couple likes seeing your spawn peeking out from behind the legs of the wedding party in nearly every picture, that's lovely. If they don't, I'm going to make damn sure they hit you with the photography bill for the wedding before I'll ever consider refunding their money.
Numero Dos: if your kids like getting into shit, keep them the fuck away from my camera bag. I'm pretty sure the shit in it is worth at least as much as your car. "Oops... I'm sorry" ain't gonna cut it if your kid breaks my shit... I don't give a flying fuck how cute he/she is.
Numero Final-O: if you've scheduled me to take family shots for you and your kids just happen to be sick that day, please call and reschedule. You're paying me to do the best job I can, so I'll be happy to work something out. Never (and I mean never) bitch about the way your kids look in the shots if you fail to reschedule in the aforementioned situation. We can do a shit-ton of things with photo processing software these days, but if your kids show up to the shoot all watery-eyed and covered in snot, you're pretty much hosed... I don't care how cute they normally are.
That will be all.
Thank you,
The camera guy
Words are totally inadequate for describing the epic win contained in the following video. Sit back, relax, crank up the volume and observe... this is how it's done:
I don't know why I didn't think of this sooner... it's so bleeding obvious.
You see, I've been suffering through a run of cold cards for months now, which makes it fairly difficult to make any respectable amount of money in a Hold'em game. A couple days ago, I hit on an idea: why not switch to a game where I can make lousy cards work for me? So now I've been playing Stud Hi/Lo, and the results are fantastic. The trick? Play for the low pot and ignore the high one... if you hit the high pot as well, it's just a nice bonus.
I think I've found a winner for the all-time most pig-ignorant thing ever said about biology from a creationist, and it comes from my old buddy Radar. Now, before I give away the money shot, we need a bit of background. You see, a while back the author made some sort of garbled argument that we've never seen bacteria turn into something other than bacteria, therefore evolution is false. Digest that one for a minute (if you're having trouble figuring out why this line of argument is so ridiculously absurd as to be a nuclear holocaust of burning stupid, look up "domains in biology"). Anyway, a commenter called him out on his glaring error a while back, and here is his response (please keep in mind that the author claims to have studied evolution carefully over the years and has often made the "I used to be an evolutionist" claim)(bolding mine):
Here is where a commenter does not tell the truth. Macroevolution is the process by which one kind of animal becomes another. He is amazed that I would even begin to think that bacteria could become anything other than bacteria, which of course would be the definition of evolution. He asks in shock if I think bacteria could "jump domain"?! As if! No, I do not believe bacteria will become anything other than bacteria. But the commenter professes to believe in macroevolution, which means that simple life became more complex and began jumping domains left and right. How many domain jumps are there between a protozoan and a horse?Of course, if the author knew fuck-all about biology, he'd realize that his question is absurd in the extreme, since protists and horses both belong to the same domain... but he's either a parody or the most proudly ignorant creationist I've ever met. I know of very few middle school life science students who would make such an elementary mistake with such a simple concept. I'm sorry to drop such a pile of brain melting stupidity on anyone, but I had to share.
What happens when you mix some bored micro people with a load of plates from old experiments? How about architecture? Here's our rendition of a certain Chicago landmark (it's not perfectly to scale even though we had enough plates... it's a matter of stability):
Of all the strange animal behaviors I've seen, that of the young kestrel from this weekend (pictured below) ranks right at the top.
I've seen plenty of birds willing to get close to humans during their daily pursuit of food, but never when said humans have guns and are frequently using them. This particular bird went so far as to buzz the lady shooting next to me (I was at a trap competition in Utah this weekend), land perhaps a foot from where I was standing and then happily munch the loads of cicadas in the grass, seemingly oblivious to the crowd and the noise. This went on for perhaps an hour, after which the well-fed bird flew back to its tree and I was able to snap a quick picture between rounds of shooting.
Needless to say, it's been a while. In fact, I appear to have missed my own blogiversary (that word still irks the shit out of me, but I don't have a better one for the time being)... fourth one, if I'm not mistaken.
Wow. Has it really been that long?
Anyway, this spring and summer have turned out to be a little more swamped than I'd foreseen, between picking up a spot as an assistant soccer coach, lab work, picture taking and time spent with the kiddo and with Geology Girl. Things don't look like they're going to slow down much until the fall semester starts, since Geology Girl returns from her field work next week and said event pretty much signals the start of our climbing season until mid-August. Guess we'll just have to see how it goes until things slow down.
Hope everyone is doing well, and pop in to say hello from time to time.
Due to a number of factors, the most extreme weather we generally see in my part of the world is usually confined to hail and thunderstorms. However, this year seems to have all the right conditions in place for brewing a tornado - a once-in-five-years occurrence here, if that. Therefore, one of the goals Geology Girl and I set for this summer was to chase at least one if the opportunity presented itself.
Yesterday evening, a fairly promising supercell popped up right about the time I left work and I decided to keep an eye on it. Sometime around seven-thirty, the National Weather Service posted a notice that the storm was showing some rotation, so I loaded up the cameras and hopped in the car. Not long after, the thing started showing some spectacular rolling and I thought a show was imminent... then it just died. Sure, I got to sit through a fantastic lightning show (no pictures... it was close enough that I decided staying in the Faraday cage - erm, car - was probably wisest) but the whole chase was a bit of a letdown.
... Then I get a call from Geology Girl late at night (she's off doing field work in the mountains for a month and a half) and guess what? Yup, she caught one without trying... in a place far more unlikely than even here. Anyway, here's her picture of the event (it never touched down, but as a one-in-a-million catch for the area, I have to show it off):
Look, I get that it's important for some of you guys that we someday turn up genetic evidence that Native Americans really are of Jewish descent... I just think you're going about it the entirely wrong way. What you really should be doing is searching the genome of random tribes for this sequence:
CACGCCGTTGCCAATGCCGGTATTTTAGCC
Hint: I've made it easy for you and typed out the coding strand sequence, so all you'll have to do is convert it directly to an RNA sequence, break it up into codons and then translate into amino acids. At that point, the reason for the chosen sequence should become painfully obvious.
* The first person to post the answer here will receive the official title of "Greatest Mormon Geneticist of All Time".
-----------------------------------------------
No takers yet? Okay, I'll make it even easier...
Step 1: convert DNA sequence to RNA. In this case (since I supplied the coding strand sequence and not the template) it's simply a matter of copying the DNA sequence and substituting a "U" in every time you encounter a "T". Thus CACGCCGTTGCCAATGCCGGTATTTTAGCC becomes CACGCCGUUGCCAAUGCCGGUAUUUUAGCC.
Step 2: break it up into codons... this just means split everything into groups of three letters, starting from the beginning. Now you'll have CAC GCC GUU GCC AAU GCC GGU AUU UUA GCC.
Finally, if you follow this link, you'll undoubtedly notice that each of these three letter chunks corresponds nicely with a specific amino acid from the link. It may take some hunting, since nearly all of the amino acids have more than one possible combination of RNA sequences, but eventually you'll have a list.
Here's the neat part: each of those amino acids in your list has not only a name, but also a three letter and single letter abbreviation. Lay out the single letter abbreviations in the order of the original sequence, and you'll have your answer.
One thing I've frequently heard or seen from fundies is the idea that God simply can't lie because He's perfect. I've always wondered how that worked out when it collides head-first into a common "young universe" argument.
Undoubtedly many of you are familiar with the creationist objection when faced with the "how can we see objects in space millions of light years away if the universe is less than 10,000 years old?" question. The usual creationist response involves God creating the stars as well as the light between them and us all at once. However, I think they need to think the whole thing through to a reasonable conclusion. You see, as far as I can tell it makes God a bit deceptive to create light en route and by doing so provide us observers with yet another piece of evidence pointing to an incredibly old universe. What makes it even worse for the "God can't lie" folks is trying to believe in a universe less than 10,000 years old and at the same time observing a supernova at a distance of greater than 10,000 light-years. You see, the problem for the believer here is that not only would God have had to create the light en route to be observed on earth within human history, but the very distance involved means that the star that exploded - get this - never actually existed in the first place. If that isn't a lie, I don't know what is.
So, fundies: is the universe very likely older than you believe, or is your god some sort of malicious trickster?
