Boom

Happy fourth, everyone:

Give me more of this poo!

Flush this poo back down!

*Choke* *Gurgle* *Die*

I think I've found a winner for the all-time most pig-ignorant thing ever said about biology from a creationist, and it comes from my old buddy Radar. Now, before I give away the money shot, we need a bit of background. You see, a while back the author made some sort of garbled argument that we've never seen bacteria turn into something other than bacteria, therefore evolution is false. Digest that one for a minute (if you're having trouble figuring out why this line of argument is so ridiculously absurd as to be a nuclear holocaust of burning stupid, look up "domains in biology"). Anyway, a commenter called him out on his glaring error a while back, and here is his response (please keep in mind that the author claims to have studied evolution carefully over the years and has often made the "I used to be an evolutionist" claim)(bolding mine):

Here is where a commenter does not tell the truth. Macroevolution is the process by which one kind of animal becomes another. He is amazed that I would even begin to think that bacteria could become anything other than bacteria, which of course would be the definition of evolution. He asks in shock if I think bacteria could "jump domain"?! As if! No, I do not believe bacteria will become anything other than bacteria. But the commenter professes to believe in macroevolution, which means that simple life became more complex and began jumping domains left and right. How many domain jumps are there between a protozoan and a horse?

Of course, if the author knew fuck-all about biology, he'd realize that his question is absurd in the extreme, since protists and horses both belong to the same domain... but he's either a parody or the most proudly ignorant creationist I've ever met. I know of very few middle school life science students who would make such an elementary mistake with such a simple concept. I'm sorry to drop such a pile of brain melting stupidity on anyone, but I had to share.

Give me more of this poo!

Flush this poo back down!

Too Much Free Time

What happens when you mix some bored micro people with a load of plates from old experiments? How about architecture? Here's our rendition of a certain Chicago landmark (it's not perfectly to scale even though we had enough plates... it's a matter of stability):

Give me more of this poo!

Flush this poo back down!

Fearless

Of all the strange animal behaviors I've seen, that of the young kestrel from this weekend (pictured below) ranks right at the top.














I've seen plenty of birds willing to get close to humans during their daily pursuit of food, but never when said humans have guns and are frequently using them. This particular bird went so far as to buzz the lady shooting next to me (I was at a trap competition in Utah this weekend), land perhaps a foot from where I was standing and then happily munch the loads of cicadas in the grass, seemingly oblivious to the crowd and the noise. This went on for perhaps an hour, after which the well-fed bird flew back to its tree and I was able to snap a quick picture between rounds of shooting.

Give me more of this poo!

Flush this poo back down!

Well...

Needless to say, it's been a while. In fact, I appear to have missed my own blogiversary (that word still irks the shit out of me, but I don't have a better one for the time being)... fourth one, if I'm not mistaken.

Wow. Has it really been that long?

Anyway, this spring and summer have turned out to be a little more swamped than I'd foreseen, between picking up a spot as an assistant soccer coach, lab work, picture taking and time spent with the kiddo and with Geology Girl. Things don't look like they're going to slow down much until the fall semester starts, since Geology Girl returns from her field work next week and said event pretty much signals the start of our climbing season until mid-August. Guess we'll just have to see how it goes until things slow down.

Hope everyone is doing well, and pop in to say hello from time to time.

Give me more of this poo!

Flush this poo back down!

Jealous

Due to a number of factors, the most extreme weather we generally see in my part of the world is usually confined to hail and thunderstorms. However, this year seems to have all the right conditions in place for brewing a tornado - a once-in-five-years occurrence here, if that. Therefore, one of the goals Geology Girl and I set for this summer was to chase at least one if the opportunity presented itself.

Yesterday evening, a fairly promising supercell popped up right about the time I left work and I decided to keep an eye on it. Sometime around seven-thirty, the National Weather Service posted a notice that the storm was showing some rotation, so I loaded up the cameras and hopped in the car. Not long after, the thing started showing some spectacular rolling and I thought a show was imminent... then it just died. Sure, I got to sit through a fantastic lightning show (no pictures... it was close enough that I decided staying in the Faraday cage - erm, car - was probably wisest) but the whole chase was a bit of a letdown.

... Then I get a call from Geology Girl late at night (she's off doing field work in the mountains for a month and a half) and guess what? Yup, she caught one without trying... in a place far more unlikely than even here. Anyway, here's her picture of the event (it never touched down, but as a one-in-a-million catch for the area, I have to show it off):

Give me more of this poo!

Flush this poo back down!

For the Mormons

Look, I get that it's important for some of you guys that we someday turn up genetic evidence that Native Americans really are of Jewish descent... I just think you're going about it the entirely wrong way. What you really should be doing is searching the genome of random tribes for this sequence:

CACGCCGTTGCCAATGCCGGTATTTTAGCC

Hint: I've made it easy for you and typed out the coding strand sequence, so all you'll have to do is convert it directly to an RNA sequence, break it up into codons and then translate into amino acids. At that point, the reason for the chosen sequence should become painfully obvious.

* The first person to post the answer here will receive the official title of "Greatest Mormon Geneticist of All Time".

-----------------------------------------------

No takers yet? Okay, I'll make it even easier...

Step 1: convert DNA sequence to RNA. In this case (since I supplied the coding strand sequence and not the template) it's simply a matter of copying the DNA sequence and substituting a "U" in every time you encounter a "T". Thus CACGCCGTTGCCAATGCCGGTATTTTAGCC becomes CACGCCGUUGCCAAUGCCGGUAUUUUAGCC.

Step 2: break it up into codons... this just means split everything into groups of three letters, starting from the beginning. Now you'll have CAC GCC GUU GCC AAU GCC GGU AUU UUA GCC.

Finally, if you follow this link, you'll undoubtedly notice that each of these three letter chunks corresponds nicely with a specific amino acid from the link. It may take some hunting, since nearly all of the amino acids have more than one possible combination of RNA sequences, but eventually you'll have a list.

Here's the neat part: each of those amino acids in your list has not only a name, but also a three letter and single letter abbreviation. Lay out the single letter abbreviations in the order of the original sequence, and you'll have your answer.

Give me more of this poo!

Flush this poo back down!

God Can't Lie... or Am I Wrong?

One thing I've frequently heard or seen from fundies is the idea that God simply can't lie because He's perfect. I've always wondered how that worked out when it collides head-first into a common "young universe" argument.

Undoubtedly many of you are familiar with the creationist objection when faced with the "how can we see objects in space millions of light years away if the universe is less than 10,000 years old?" question. The usual creationist response involves God creating the stars as well as the light between them and us all at once. However, I think they need to think the whole thing through to a reasonable conclusion. You see, as far as I can tell it makes God a bit deceptive to create light en route and by doing so provide us observers with yet another piece of evidence pointing to an incredibly old universe. What makes it even worse for the "God can't lie" folks is trying to believe in a universe less than 10,000 years old and at the same time observing a supernova at a distance of greater than 10,000 light-years. You see, the problem for the believer here is that not only would God have had to create the light en route to be observed on earth within human history, but the very distance involved means that the star that exploded - get this - never actually existed in the first place. If that isn't a lie, I don't know what is.

So, fundies: is the universe very likely older than you believe, or is your god some sort of malicious trickster?

Give me more of this poo!

Flush this poo back down!

Rho and the Art of "Own Goal"

Much like conservation of momentum, death, taxes and in-laws, it's a law of the universe that creationists and fundies will score "own goals" if you just give them enough time. As TalkOrigins' own Lenny Flank is fond of pointing out, fighting creationists on legal matters is often as simple as letting them run their mouths uninterrupted; they'll eventually shoot themselves in the foot every time. On that note, I've found someone so spectacularly good at the fine art of "own goal" that not only did the other team not have to try... they simply left the field at half-time and never bothered to come back.

Those of you who have spent any amount of time at ERV will no doubt remember a commenter who goes by Rhology with an annoying habit of arguing like a first semester philosophy student who takes the shit waaaaaay too seriously. Here, he decides to take on a "top ten signs you're a fundamentalist" list from EvilBible.com. Hilarity ensues throughout the entire post, but the money shot is this one (Rho's response in bold):

2 - You define 0.01% as a "high success rate" when it comes to answered prayers. You consider that to be evidence that prayer works. And you think that the remaining 99.99% FAILURE was simply the will of God.

-Again we encounter problems of definition. 100% is the success rate for prayers; God answers every single one. And a lot of the time the answer is No, or Wait. What is EB.com's argument for why we should accept their own implicit definition rather than the Christian one?
-And of course, this mistakes the purpose of prayer. Prayer is not the activation of man's will in Heaven, but rather of God's will in man's heart and on Earth. It is my communication with God that makes ME holier and more like Christ.
-Why would we think that an omniscient and good God would answer every prayer with a "Heck yeah" whenever we ask? Didn't Ali Baba see "Bruce Almighty", wherein Bruce/God answers all 4.5 million prayers with a Yes To All? And the chaos that ensues? Yes, it was Hollywood, but on that one they got it exactly right.
-EB.com would perhaps want to define "answered prayer" as a miraculous intervention of God. But aren't miracles by conventional definition rare occurrences? Further, a lot of "failures" are actually "Wait/Not yet"-type answers, misunderstood by the pray-er, who just KNEW that it would all fall apart if he doesn't get deliverance RIGHT NOW b/c he doesn't see the big picture or the big plan like God does.

GOOOOOAAAAAALLLLL!!!

Hilarious... almost as good as saying that the line in the Bible about "there will be doubters" is actually prophetic.

An ending thought: if any fundies aren't afraid to test the "God answers all prayers" hypothesis, I have a simple home experiment for you: spend a month praying to God while tracking both the prayer and the "answer" on a spreadsheet... then spend a month praying to the cat. If God really does anything at all, there should be a significant difference between the two. That's all.

Give me more of this poo!

Flush this poo back down!

Thoughts

I'm back from yet another short hiatus and, while I haven't yet found a replacement purring furball, I'm feeling much better. I have a couple things in the pipeline for posting when I finally catch up with work, but for now I'll leave you with a thought:

The new Star Trek movie kicks ass. I'd hesitate to call it "movie of the year" already, since the year is not yet half over, but it's certainly a contender. Go see it, even if you've never been a Trek fan. With the exception of Wrath of Khan, the new one is by far my favorite.

Give me more of this poo!

Flush this poo back down!

Bad News

In an exceedingly rare (in that he's not purebred) and sad turn of events, it looks like my cat has polycystic kidney disease and I'm going to have to euthanize him sometime in the next 48 hours while he's still somewhat comfortable. Seeing as how I've had him since the moment he was born (I picked him as a keeper because rather than crying or hissing when I handled him minutes after birth, he purred) and that was seven years ago, I'm more than a bit down about the whole thing... he's been like a second child to me, despite my penchant for randomly changing his name every six months or so. It's going to be awfully difficult to find another kitty with both his sheer size (I love big cats) and friendly attitude... to say nothing of the random baths he insists on giving both myself and Geology Girl anytime he gets close enough.

Damn it... I was hoping to have him at least six or seven more years. This sucks.

Give me more of this poo!

Flush this poo back down!

Ponderable

Is it just me, or is there something immeasurably creepy about the "king" in the Burger King commercials? Discuss.

Give me more of this poo!

Flush this poo back down!

CoffeeCoffeeCoffeeCoffee...

I really wasn't going to bitch anymore about the ASM meeting from a couple weeks ago, but something has been rubbing me the wrong way and I need to let it out...

You see, one of the BYU kids attempting to prop up his beliefs was testing caffeine against cell cultures to see if it could cause cancer. Okay... whatever. What rubs me wrong is how he pulled it off. Apparently they managed to finally get some slight tumor formation by testing the cells in 20 millimolar caffeine. Now, that might not sound like much up front, but here's how it boils down:

If we round of the formula weight of caffeine to 194.2, 20 millimolar will be 3884mg per liter of solution. Now, multiply that by 5 liters of blood in the average human adult and we have 19,420mg. For one thing, if all the caffeine in every single cup of coffee went straight to the blood, you'd have to take somewhere around 140 cups of coffee in a single slug. As bad as that sounds, it's the least of your worries. You see, if we take that 19,420mg of caffeine into the average adult body mass of 83kg, that leaves us with about 234mg/kg of caffeine in your body. Since the LD₅₀ for caffeine is 192mg/kg as tested in a rat model, and since you'd be at 122% of the LD₅₀ if your blood caffeine level was at 20mM, I think cancer would be the least of your worries... not to mention how you'd even begin to ingest 140 cups of coffee in one slug (again, that's assuming every single molecule of caffeine was absorbed into your blood... in theory you could pull it off by downing around 100 extra-strength caffeine pills instead).

I drink a lot of the crap (as Geology Girl could probably tell you), but Jeebus.

Give me more of this poo!

Flush this poo back down!

Mocking the System

It wasn't so long ago that I complained about the audacity of a fiscally irresponsible school district administration in asking for a ton of money from area taxpayers to bail them out of financial trouble - much as they've been doing for quite a while now but much larger in amount. It seems one of our frequent newspaper blog commenters displayed the gift of prophesy (or perhaps just an excellent ability to put two and two together) when he said, prior to the first bond election, that if the district didn't like the way things turned out, they'd turn around and have another special bond election - again and again - until they got the answer they wanted in the first place simply because voters would tire of telling them no. Well, as it turns out he was right and they're hosting another vote today, albeit for a much more reasonable amount. I suspect this one will pass, considering that the district lately has been making lots of noise about cutting athletics to make ends meet - a grave sin in this area if ever there was one; academics be damned.

I feel bad for having to vote against the levy yet again, especially considering that the amount is close enough to previous requests that taxes will be unaffected. However, I have to vote "no" on principle. You see, in my opinion it's a mockery of the whole democratic process to be able to hold special elections as many times as necessary in order to get what they want... much like the child begging for an unearned cookie continuously until the parent gives in. Giving in now simply sends the message that area voters can be bullied into compliance. Sorry, but not this voter.

Also contributing to the issue is the fact that they're complaining of a lack of money for books and paper for students, yet at the same time feel the need to pepper the district with fliers and such urging a "yes" vote. That in itself should be enough to make any reasonable voter sit up and take notice. Sadly, I think most won't, and the district will continue on as if reforms are for "other" folks.

Update: the levy passed last night by a nearly three-to-one margin... seems the district's tactics worked out for them.

Give me more of this poo!

Flush this poo back down!

Me Wanty

I'd almost completely forgotten about polychaete worms until the exiting discovery at a UK aquarium a couple days ago. Sadly, since the closest ocean is a day's drive away from me and since the local pet stores don't carry such cool beasties, I'm going to have to satisfy myself by snagging one of the preserved ones used in our 100-level biology labs. The lab coordinator said she'd even put one in a jar for me to have for a desk decoration if I want. Isn't that awfully nice?

Give me more of this poo!

Flush this poo back down!